automacs pro washing solution (Miltenyi Biotec)
Miltenyi Biotec is a verified supplier 
Miltenyi Biotec manufactures this product 
94
Structured Review
Miltenyi Biotec
automacs pro washing solution
Automacs Pro Washing Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/washing+solution/autoMACS+Washing+Solution/pmc13101284-58-0-5
Average 94 stars, based on 19 article reviews
Automacs Pro Washing Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/washing+solution/autoMACS+Washing+Solution/pmc13101284-58-0-5
Average 94 stars, based on 19 article reviews
automacs pro washing solution - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Flow Cytometry:Article Title: An assay to probe Plasmodium falciparum growth, transmission stage formation and early gametocyte development Article Snippet: .. Hypoxanthine (Sigma, cat. no. H9377) NaHCO 3 (Sigma, cat. no. S5761) Flow cytometry buffers and calibration beads (Miltenyi Biotec, or as appropriate for your instrument) Running buffer (Miltenyi, cat. no. 130-092-747) Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with MACSQuant running buffer, storage solution, and Sterility:Article Title: An assay to probe Plasmodium falciparum growth, transmission stage formation and early gametocyte development Article Snippet: .. Hypoxanthine (Sigma, cat. no. H9377) NaHCO 3 (Sigma, cat. no. S5761) Flow cytometry buffers and calibration beads (Miltenyi Biotec, or as appropriate for your instrument) Running buffer (Miltenyi, cat. no. 130-092-747) Pore Size:Article Title: An assay to probe Plasmodium falciparum growth, transmission stage formation and early gametocyte development Article Snippet: .. Hypoxanthine (Sigma, cat. no. H9377) NaHCO 3 (Sigma, cat. no. S5761) Flow cytometry buffers and calibration beads (Miltenyi Biotec, or as appropriate for your instrument) Running buffer (Miltenyi, cat. no. 130-092-747) Blocking Assay:Article Title: Nucleic acid conjugate Article Snippet: A washing solution for cells was prepared by adding 2.5 mL of a 10% sodium azide solution (manufactured by Nacalai Tesque, Inc.) and 685 μL of a 0.5 M EDTA solution (EDTA (0.5 M), pH 8.0, manufactured by Ambion, Inc., AM9260G) to 500 mL of phosphate-buffered saline containing 1% (w/v) BSA. .. To this Incubation:Article Title: Neural stem cells deriving from chick embryonic hindbrain recapitulate hindbrain development in culture Article Snippet: Briefly, hindbrain cell suspension was obtained from st.18 HH embryos and incubated with mouse anti-CD57 (HNK1) antibody (1:400, #560844; BD Biosciences, USA) for 60 min at RT. .. After applying other:Article Title: Antimicrobial Effectiveness of Bioactive Silver Nanoparticles Synthesized by Actinomycetes HGG16n Strain. Article Snippet: DOI: 10.2174/13892010186661701041124 34 Abstract: Background: Biologically synthetized silver nanoparticles are promising antimicrobial agent.. Flow cytometry, well diffusion methods, colony-forming units (CFU) and spectroscopic approach are commonly used in antimicrobial study.. The aim of this study was investigation of effectiveness of BioAgNPs synthesized by Actinomycetes HGG16n using fluorescence flow cytometry method as an alternative to the standard ones (well and disc diffusion method). Passaging:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with MACSQuant running buffer, storage solution, and Suspension:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with MACSQuant running buffer, storage solution, and Concentration Assay:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with MACSQuant running buffer, storage solution, and |